15.02 RNA NGS preparation
Overview¶
We use Lexogen Small RNA-Seq Library Preparation Kit for sequencing short RNAs, like gRNAs.

- Final product composition:
- P5 (23 nt): AATGATACGGCGACCACCGAGAT
- SP1 (sequencing primer; also called an adaptor or a linker; 32 nt): CTACACGTTCAGAGTTCTACAGTCCGACGATC
- Your sequence
- SP2 (sequencing primer; also called an adaptor or a linker; 33 nt): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
- i7 (6 nt): Listed in the Lexogen manual. If an 8 nt i7 index needs to be entered into an Illumina sample sheet, e.g., if libraries are multiplexed with other 8 nt index libraries, add two nucleotides from the Illumina adapter sequence to the 3’ end of the i7 index sequence (i.e., P7). Example: SRi7001 would become CAGCGTAT, SRi7002 would become GATCACAT and so on.
- P7 (24 nt): ATCTCGTATGCCGTCTTCTGCTTG
- Linker-linker artifacts result in ~65 bp sequences (32 + 33) and ~120 bp (65 + 23 + 24), thus in Bioanalyzer we should only look at fragments >120 bp in length.
A3, A5, and RTP dilution, ethanol and PCR cycles adjustments¶
| Input RNA amount | Dilution factor | Ethanol (uL), Step 5 | Number of PCR cycles |
|---|---|---|---|
| 100 - 1000 ng | 1X | 50 (optional: 100) | 12-15 |
| 1 - 100 ng | .5X | 50 | 16-20 |
| 50 pg - 1 ng | .5 to .3X | 50 | 20-22 |
Upon receiving the kit¶
- Aliquot PCR mix into PCR tubes with 55 uL each.
- Add 90 mL of 100% ethanol to CW and shake to combine.
Procedure¶
- All steps carried out at 20-25C.
- Thaw all buffers to room temperature unless indicated otherwise. Vortex or pipette briefly and spin down before opening.
- If white precipitate is visible in CB or CW, incubate them at 37C until buffer components dissolve completely.
- Thermocycler lid: 105C.
3' Adapter Ligation¶
Thaw water, A3, and LM1 to room temperature.
- Dilute A3 according to the Dilution factor in the table above. If you have n samples, make sure you get at least n uL of the diluted A3.
- Dilute input RNA with nuclease-free water to 6 uL.
- Add 1 uL of diluted A3.
- Denaturing: Incubate for 2 min at 70C preheated thermocycler and place on ice.
- Total volume: 7 uL.
- Spin down before opening.
- Master Mix (mix well and spin down)
| Component | Per reaction (uL) | Per reaction + 10% (uL) |
|---|---|---|
| Ligation Mix 1 (LM1) | 12 | 13.2 |
| Enzyme Mix 1 (E1) | 1 | 1.1 |
- Add 13 uL of Master Mix to the RNA/A3 sample and incubate at 28C for 1 h.
- Total volume: 20 uL.
- Mix well and spin down.
- Store at -20C if needed.
Removal of Excess 3' Adapter¶
-
Pre-cool centrifuge to 18C.
-
Transfer 3' adapter ligation reaction (20 uL) to 1.5 mL tube.
- Add 300 uL Column Binding Buffer (CB).
- Mix well by pipetting.
- Add 50 uL (adjust based on the table at the top) of 100% EtOH and mix well.
- Transfer onto a Purification Column placed in a 2 mL Collection Tube.
- Centrifuge for 1 min at 3500 g (~6000 rpm) at 18C.
- Discard flow-through.
- Add 600 uL Column Wash Buffer (CW) and centrifuge for 1 min at 14000 g (~12000 rpm) at 18C.
- Discard the flow-through.
- Centrifuge for 2 min at 14000 g (~12000 rpm) at 18C to dry the column.
- Transfer to a new 1.5 mL tube and add 12 uL Elution Buffer (EB).
- Centrifuge for 1 min at 200 g (~1400 rpm) at 18C.
- Centrifuge for 2 min at 14000 g (~12000 rpm) at 18C to elute 3' adapter-ligated RNA.
- Transfer the eluate into an PCR tube.
- Note that at this point Qubit measurement of the concentration may not indicate the true concentration of the ligated product.
5' Adapter Ligation¶
Thaw water, A5, and LM2 to room temperature.
- Dilute A5 according to the Dilution factor in the table above. If you have n samples, make sure you get at least n uL of the diluted A5.
- Denaturing: Incubate for 2 min at 70C preheated thermocycler and place on ice.
- Spin down before opening.
- Master Mix (mix well and spin down):
| Component | Per reaction (uL) | Per reaction + 10% (uL) |
|---|---|---|
| 5' Adapter (A5) | 1 | 1.1 |
| Ligation Mix 2 (LM2) | 11 | 12.1 |
| Enzyme Mix 2 (E2) | 1 | 1.1 |
- Add 13 uL of Master Mix to the RNA/A3 sample and incubate at 28C for 1 h.
- Total volume: 25 uL.
Reverse Transcription of Ligated RNA¶
Thaw RTP and FS to room temperature.
- Dilute Reverse Transcription Primer (RTP) according to the Dilution factor in the table above. If you have n samples, make sure you get at least n uL of the diluted RTP.
- Add 1 uL diluted RTP to the finished 5' adapter ligation reaction.
- Mix well and spin down.
- Denaturing: Incubate for 2 min at 70C preheated thermocycler and place on ice.
- Spin down before opening.
- Master Mix (mix well and spin down):
| Component | Per reaction (uL) | Per reaction + 10% (uL) |
|---|---|---|
| First Strand cDNA Synthesis Mix (FS) | 8 | 8.8 |
| Enzyme Mix 3 (E3) | 1 | 1.1 |
- Add 9 uL of Master Mix to the denatured reaction product and incubate in a pre-heated thermocycler at 50C for 1 h.
- Total volume: 35 uL.
- Spin down.
- Store at -20C if needed.
Library Amplification¶
Thaw PCR, P5, indices, and water to room temperature.
- Spin down the Small RNA i7 Index Primer (SRi7001-7096) plate
- In Biosan CVP-2, Use Quick Spin button or run 1000 rpm for spin and 300 rpm for vortex for 1 min ottal).
- Make sure to counterbalance the plate with another plate, not with adapters that are placed in the centrifuge/vortex device.
- Check that you see liquid at the bottom.
- Reseal opened wells to prevent cross contamination.
- Master Mix (mix well and spin down):
| Component | Per reaction (uL) | Per reaction + 10% (uL) |
|---|---|---|
| PCR Mix (PCR) | 50 | 55 |
| P5 Primer (P5) | 3 | 3.3 |
| Nuclease-free water | 11 | 12.1 |
| Number of samples | 1 |
- Add 64 uL Master Mix to 33 uL sample.
- Add 3 uL of indices, mix well and spin down.
- Conduct thermocycling, using the number of cycles based on the table above:
| Stage | Cycle step | Temperature (°C) | Time (s) | Cycles |
|---|---|---|---|---|
| 1 | Initial denaturation | 98 | 30 | 1 |
| 2 | Denaturation | 98 | 10 | 12-22 |
| Annealing | 60 | 30 | ||
| Extension | 72 | 15 | ||
| 3 | Final extension | 72 | 10 min | 1 |
| Incubation | 10 | Hold | Hold |
Purification¶
- Transfer the finished PCR reaction (~100 uL) to a 1.5 mL tube.
- Add 300 uL Column Binding Buffer (CB), mix well by pipetting.
- Add 50 uL 100% ethanol to the reaction, mix well.
- Transfer onto a Purification Column in a 2 mL Collection Tube.
- Centrifuge for 1 min at 3500 g (~6000 rpm) at 18C.
- Discard flow-through.
- Repeat twice:
- Add 600 uL Column Wash Buffer (CW) and centrifuge for 1 min at 14000 g (~12000 rpm) at 18C.
- Discard the flow-through.
- Centrifuge for 2 min at 14000 g (~12000 rpm) at 18C to dry the column.
- Transfer to a new 1.5 mL tube and add 20 uL Elution Buffer (EB).
- Centrifuge for 1 min at 200 g (~1400 rpm) at 18C.
- Centrifuge for 2 min at 14000 g (~12000 rpm) at 18C to elute 3' adapter-ligated RNA.
- Transfer the eluate into an PCR tube.